View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14920_high_13 (Length: 270)
Name: NF14920_high_13
Description: NF14920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14920_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 8 - 254
Target Start/End: Original strand, 37734103 - 37734349
Alignment:
| Q |
8 |
aagcaaaggtgacaatgacaatgaagaagatacggattacgattccgatgaggatgatgaggatgttgatggtgatgaggacggtgataatcaggttgta |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37734103 |
aagcgaaggtgacaatgacaatgaagaagatacggattacgattccgatgaggatgatgatgatgttgatggtgatgaggacggtgataatcaggttgta |
37734202 |
T |
 |
| Q |
108 |
ccttggtcgtcaacggcggcgcagcctccaccggcttcgagttcctccggtagcgatgagtcggtttcggttagcaagtgcaacgataaccacgatgagg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37734203 |
ccttggtcgtcaacggcggcgcagcctccaccggcttcgagttcctccggtagcgatgagtcggtttcggttagcaagtgcaacgataaccacgatgagg |
37734302 |
T |
 |
| Q |
208 |
ttatttcgaagttagttacaacgatttctttgaaacgacgtcgtttg |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37734303 |
ttatttcgaagttagttacaacgatttctttgaaacgacgtcgtttg |
37734349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University