View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14920_high_17 (Length: 229)
Name: NF14920_high_17
Description: NF14920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14920_high_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 22 - 206
Target Start/End: Complemental strand, 40329232 - 40329050
Alignment:
| Q |
22 |
aaaatatgtattgatgtcttgtttgttaccaaaattgtaaagaatgtatgtgtttacgtatagtgggttttagtagggtagagcatcggacgggttcaag |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| || |||| | |
|
|
| T |
40329232 |
aaaatatgtattgatgtcttgtttgttaccaaaattgtaaagaattt--gtgtttacgtatagtgggttttagtagggtagagcatcggatggattcagg |
40329135 |
T |
|
| Q |
122 |
cccgaaagaggcataccagatgaaaccgatcactcaatcttaagacccaaattcgaccactcatgtactcggtttgctcgggttc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40329134 |
cccgaaagaggcataccagatgaaaccgatcattcaatcttaagacccaaatttgaccactcatgtactcggtttgctcgggttc |
40329050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University