View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14920_high_20 (Length: 216)
Name: NF14920_high_20
Description: NF14920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14920_high_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 23 - 195
Target Start/End: Complemental strand, 36822759 - 36822580
Alignment:
| Q |
23 |
taaagtacgtattttaatggtggatgagaggaatggggggtgagacaagaagaaaatttctaatctaaaattctcaataattat-------attgaaatt |
115 |
Q |
| |
|
|||| ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36822759 |
taaaatacgtattttattggtgtatgagaggaatggggggtgagacaagaagaaaatttctaatctaaaattctcaataattatcgtgcatattgaaatt |
36822660 |
T |
|
| Q |
116 |
tgtcaaggatcttttaaaataagtaaaatgtaaaatgataaaatcaatagttgttattgtaacaaacttgctgtaacagg |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36822659 |
tgtcaaggatcttttaaaataagtaaaatgtaaaatgataaaatcaatagttgttattgtaacaaacttgctgtaacagg |
36822580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 131 - 183
Target Start/End: Complemental strand, 39790192 - 39790140
Alignment:
| Q |
131 |
aaaataagtaaaatgtaaaatgataaaatcaatagttgttattgtaacaaact |
183 |
Q |
| |
|
||||||| |||| |||||| |||||||||||| |||||||||| || |||||| |
|
|
| T |
39790192 |
aaaataaataaagtgtaaagtgataaaatcaagagttgttattatagcaaact |
39790140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University