View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14920_high_23 (Length: 205)
Name: NF14920_high_23
Description: NF14920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14920_high_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 18 - 191
Target Start/End: Original strand, 40216260 - 40216433
Alignment:
| Q |
18 |
agaagtggggttttaccattttgataattgggttggttgagattttaaggaattgatttttaggtgggttttgatggatattgatgggaatacacacaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40216260 |
agaagtggggttttaccattttgataattgggttggttgagattttaaggaattgatttttaggtgggttttgatggatattgatgggaatacacacaag |
40216359 |
T |
|
| Q |
118 |
agctacaaaatattgaaagagagattgattaatcagaggattaagggactttgttgaaagcaaagaggaggagc |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
40216360 |
agctacaaaatattgaaagagagattgattaatcagaggataaagggactttgttgaaagcaaagagtaggagc |
40216433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University