View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14920_high_8 (Length: 322)
Name: NF14920_high_8
Description: NF14920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14920_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 13 - 298
Target Start/End: Original strand, 43051628 - 43051913
Alignment:
| Q |
13 |
tactattatgatcaagtgaaattgctctaatcaatttttatttatgattatttttcagattaagcctcaagagaacactgatattatgaaagattttgac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43051628 |
tactattatgatcaagtgaaattgctctaatcaatttttatttatgattatttttcagattaagcctcaagagaacactgatattatgaaagattttgac |
43051727 |
T |
 |
| Q |
113 |
gaacctggtcatcttgctcctacgggcttgcaccttgcaggagtcaaatacatggtcatccaaggagagtctggtgctgtcatccgtgggaagaaggtaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43051728 |
gaacctggtcatcttgctcctacgggcttgcaccttgcaggagtcaaatacatggtcatccaaggagagtctggtgctgtcatccgtgggaagaaggtaa |
43051827 |
T |
 |
| Q |
213 |
attattcaatttcgcacacaaatttctagtattcatattattgaggttgtatttaagtctcatgttgtcaatattttcgagttgtt |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43051828 |
attattcaatttcgcacacaaatttctagtattcatattattgaggttgtatttaagtctcatgttgccaatattttcgagttgtt |
43051913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 63 - 212
Target Start/End: Complemental strand, 34173209 - 34173060
Alignment:
| Q |
63 |
tttttcagattaagcctcaagagaacactgatattatgaaagattttgacgaacctggtcatcttgctcctacgggcttgcaccttgcaggagtcaaata |
162 |
Q |
| |
|
|||| ||| |||||||| | |||| |||| ||| ||||||||||| |||||||| || |||||||| ||||| ||| ||||||||| | | |||| || |
|
|
| T |
34173209 |
ttttacagtttaagcctgatgagattactggtatcatgaaagatttcgacgaaccaggacatcttgcacctactggcatgcaccttggggaaatcaagta |
34173110 |
T |
 |
| Q |
163 |
catggtcatccaaggagagtctggtgctgtcatccgtgggaagaaggtaa |
212 |
Q |
| |
|
|||||| || ||||||||| |||| |||||||| |||||||||||||||| |
|
|
| T |
34173109 |
catggttattcaaggagagcctggagctgtcattcgtgggaagaaggtaa |
34173060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University