View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14920_low_17 (Length: 232)
Name: NF14920_low_17
Description: NF14920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14920_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 66 - 217
Target Start/End: Complemental strand, 50371684 - 50371533
Alignment:
| Q |
66 |
gtgtaatggaaacagtgagatttgaactttggattttcgatcatgcatattatattactcaaacccctcacaactagttttctgaatttatgatctaact |
165 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50371684 |
gtgtaatggaaacagtgtgatttgaactttggattttcgatcatgcatattatattactcaaacccctcacaactagttttctgaatttatgatctaact |
50371585 |
T |
|
| Q |
166 |
acacagtttcattcatttattcttattttctgtattgattttggtatatact |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50371584 |
gcacagtttcattcatttattcttattttctgtattgattttggtatatact |
50371533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University