View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14920_low_18 (Length: 229)

Name: NF14920_low_18
Description: NF14920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14920_low_18
NF14920_low_18
[»] chr5 (1 HSPs)
chr5 (22-206)||(40329050-40329232)


Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 22 - 206
Target Start/End: Complemental strand, 40329232 - 40329050
Alignment:
22 aaaatatgtattgatgtcttgtttgttaccaaaattgtaaagaatgtatgtgtttacgtatagtgggttttagtagggtagagcatcggacgggttcaag 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |  ||||||||||||||||||||||||||||||||||||||||| || |||| |    
40329232 aaaatatgtattgatgtcttgtttgttaccaaaattgtaaagaattt--gtgtttacgtatagtgggttttagtagggtagagcatcggatggattcagg 40329135  T
122 cccgaaagaggcataccagatgaaaccgatcactcaatcttaagacccaaattcgaccactcatgtactcggtttgctcgggttc 206  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||    
40329134 cccgaaagaggcataccagatgaaaccgatcattcaatcttaagacccaaatttgaccactcatgtactcggtttgctcgggttc 40329050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University