View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14920_low_19 (Length: 228)
Name: NF14920_low_19
Description: NF14920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14920_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 8 - 205
Target Start/End: Complemental strand, 104983 - 104787
Alignment:
| Q |
8 |
gagaagcataggtggaagaaaggtaatttactggctctataaaatccaaaattgtgattccattccaaatgcataatgtagnnnnnnnnnnnnnnnnnnn |
107 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
104983 |
gagaaacaaaggtggaagaaaggtaatttactggctctataaaatccaaaattgtgattccattccaaatgcataatgtagtaatataatataatataat |
104884 |
T |
 |
| Q |
108 |
nnnnntggactatagaaaaagtaagctgtggtcttcttgttacattatatgtatgctcattcatgttagtgttatgcaaaaatagaagcatcatcaac |
205 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
104883 |
ataattggactatagaaaaagtaagctgtggt-ttcttgttacattatatgtatgctcattcatgttagtgttatgcaaaaatagaagcatcatcaac |
104787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University