View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14920_low_7 (Length: 324)
Name: NF14920_low_7
Description: NF14920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14920_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 1 - 313
Target Start/End: Original strand, 43533767 - 43534079
Alignment:
| Q |
1 |
gatctgctgccggcctctctgctggtttcaatgctgccgttgctggttgtttcttcgctgttgagtctgtcttgtggccttctgattctgattcttctaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43533767 |
gatctgctgccggcctctctgctggtttcaatgctgccgttgctggttgtttcttcgctgttgagtctgtcttgtggccttctgattctgattcttctaa |
43533866 |
T |
|
| Q |
101 |
tttatcgcttactaatactacttccacagtcattctcagtgctgtcattgcttctgtcatttctgagattggccttggctctgaacctgcctttcaagtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43533867 |
tttatcgcttactaatactacttccacagtcattctcagtgctgtcattgcttctgtcatttctgagattggccttggctctgaacccgcctttcaagtt |
43533966 |
T |
|
| Q |
201 |
ccagactacgactttcgttctcctgctggtaagtaacttactgattgatatcatgattttgaatttcaacaaaacaaaacctgatatcatatcatatcat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43533967 |
ccagactacgactttcgttctcctgctggtaagtaacttactgattgatatcatgattttgaatttcaacaaaacaaaacctgatatcatatcatatcat |
43534066 |
T |
|
| Q |
301 |
tattcaacttcat |
313 |
Q |
| |
|
||||||||||||| |
|
|
| T |
43534067 |
tattcaacttcat |
43534079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University