View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14922_high_15 (Length: 263)
Name: NF14922_high_15
Description: NF14922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14922_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 15 - 247
Target Start/End: Complemental strand, 25742844 - 25742614
Alignment:
| Q |
15 |
aaaggccaagttgaatgaaaaggaacttcttgaaaagttacttttggaatggagtgagaatgctgatactgacaattcacaacaagaaaaagacatacta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25742844 |
aaaggccaagttgaatgaaaaggaacttcttgaaaagttaattttggaatggggtgagaatgctgatactgacaattcacaacaagaaaaagacatacta |
25742745 |
T |
 |
| Q |
115 |
gacaggttacagccccatacaaatattaaagagctttctatacataactacctagggacggaatttcctagttgggtcggagactcttccttctacaact |
214 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25742744 |
gacaggttacagccccatacaaatctt--agagctttctatacataactacctagggacagaatttcctaattgggtcggagactcttccttctacaact |
25742647 |
T |
 |
| Q |
215 |
tgttgttcatggagctccagggtagcaaatatt |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
25742646 |
tgttgttcatggagctccagggtagcaaatatt |
25742614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University