View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14922_high_16 (Length: 254)
Name: NF14922_high_16
Description: NF14922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14922_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 123 - 242
Target Start/End: Original strand, 2265691 - 2265810
Alignment:
| Q |
123 |
cgtcaaaggaatatagagaaattaaagtaataaatattacctatctccaactaggtcgtacatcctgcgaatgagatcctcctcttgctcgctcatctct |
222 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2265691 |
cgtcaaaggaatatagagaaattaaaggaataaatattacctatctccaactaggtcgtacatcctgcgaatgagatcctcctcttgctcgctcatctct |
2265790 |
T |
 |
| Q |
223 |
atgaactcccactctgtgct |
242 |
Q |
| |
|
|||||||||||||| ||||| |
|
|
| T |
2265791 |
atgaactcccactcagtgct |
2265810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 2265542 - 2265653
Alignment:
| Q |
1 |
atcataatggatccccgaccatgattttgagaaaccctcggcttctttataattgtagttcttgcagaattatttgttcttatctattaaccttaaaacg |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2265542 |
atcataatggatcaccgaccatgattttgagaaaccctcggcttctttataattgtagttcttgcagaattatttgttcttatctattaaccttaaaacg |
2265641 |
T |
 |
| Q |
101 |
tcaaagcttctt |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
2265642 |
tcaaagcttctt |
2265653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University