View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14922_high_4 (Length: 426)
Name: NF14922_high_4
Description: NF14922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14922_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 1e-91; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 1e-91
Query Start/End: Original strand, 9 - 230
Target Start/End: Original strand, 46748310 - 46748521
Alignment:
| Q |
9 |
agcataggaagattttgtcccttacataggaaagtggcgttatgctggggctaccctttttggtggctgctgtaggaccactcccaaaactattagaggc |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46748310 |
agcagaggaagattttgtcccttacataggaaagtggcgttatgctggggctaccctttttggtggctgctgtaggaccactcccaaaactattagaggc |
46748409 |
T |
|
| Q |
109 |
ataaccgaggcattatatggaaagcctcatggcaaatgtgtataaaatgttgattgatgttgaagtatggtttatcttatgtgtgtaataattaatgatg |
208 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46748410 |
ataaccgaggcattatatggaaaacctcatggcaaatgtatataaa----------ctgttgaagtatggtttatcttatgtgtgtaataattaatgatg |
46748499 |
T |
|
| Q |
209 |
gaacaaatgatcataacaataa |
230 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
46748500 |
gaacaaatgatcataacaataa |
46748521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 321 - 413
Target Start/End: Original strand, 46748552 - 46748644
Alignment:
| Q |
321 |
acaaattggatatatgccaaacaatctctaatttctataatataaattacttgccctacctgtttccgtttgtgcaaacttttgaatgatagt |
413 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46748552 |
acaaattggatatatgccaaacaatctctaatttctataatataaattacttgccctacctgtttccgtttgtgcaaacttttgaatgatagt |
46748644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University