View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14922_low_10 (Length: 396)
Name: NF14922_low_10
Description: NF14922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14922_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 66 - 379
Target Start/End: Complemental strand, 40581928 - 40581587
Alignment:
| Q |
66 |
tacgcgtcagttacataagtttgatttgaaataatggaagccatatatggagatgctataaaagacatgacatgttgcactagagcacatgcata----- |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40581928 |
tacgcgtcagttacataagtttgatttgaaataatggaagccatatatggagatgctataaaagacatgacatgttgcactagagcgcatgcatatacag |
40581829 |
T |
|
| Q |
161 |
----------------cccaacaatatttcttttatagtgatttgaattgcaaatggtttatgaatcggaatcaacaacgtttgcatccatgcatgcata |
244 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40581828 |
tacaccttagtacttacccaaaaatgtttcttttatagtgatttgaattgcaaatggtttatgaatcggaatcaacaacgtttgcatccatgcatgcata |
40581729 |
T |
|
| Q |
245 |
tata------attccggtatcttatcctttccatcatcatcctgtggaggctggagccacctttcatgtcatgggctttcatcgttttatgttcgttcct |
338 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40581728 |
tatatatataattccggtatcttatcctttccattatcatcctgtggaggctggagccacctttcatgtcatgggctttcatcgtcttatgttcgttcct |
40581629 |
T |
|
| Q |
339 |
cgagtcaac-nnnnnnngcccatcattttgaaaaactaacat |
379 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40581628 |
cgagtcaacttttttttgcccatcattttgaaaaactaacat |
40581587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 40582058 - 40582001
Alignment:
| Q |
1 |
tgaataatgattagttttgggaacaattaatctcctctccctagattttacatcttac |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40582058 |
tgaataatgattagttttgggaacaattaatctcctctccctagattttacatcttac |
40582001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University