View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14923_high_4 (Length: 341)
Name: NF14923_high_4
Description: NF14923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14923_high_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 14 - 226
Target Start/End: Complemental strand, 5479307 - 5479095
Alignment:
| Q |
14 |
aacctgtgttgaaccattgtcaatgtagcctttgtacacatggccgaatcctccaactccgacgatgaagagtccatcgaagttgtttgtggcggcacgg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
5479307 |
aacctgtgttgaaccattgtcaatgtagcctttgtacacatggccgaatcctccaactccgacaatgaagagttcgtcgaagttgtttgtggcagcacga |
5479208 |
T |
 |
| Q |
114 |
atctctaggagggagaagctccggcagagatccgacggtagagatgagtttgaatgtgttgattttgttgttgttgcaaatgacaatggaccccattttg |
213 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5479207 |
atctctagaagggagaagctccggcagagatccgatggtagagatgtgtttgaatttgttgattttgttgttgttgcaaatgacaatggaccccactttg |
5479108 |
T |
 |
| Q |
214 |
aagttgtcgaaga |
226 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
5479107 |
aagtcgtcgaaga |
5479095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 33 - 109
Target Start/End: Complemental strand, 4712747 - 4712671
Alignment:
| Q |
33 |
tcaatgtagcctttgtacacatggccgaatcctccaactccgacgatgaagagtccatcgaagttgtttgtggcggc |
109 |
Q |
| |
|
|||||||| ||||||||||| | ||||||||||||||| |||| ||| || | | |||||||||||||| ||||| |
|
|
| T |
4712747 |
tcaatgtaacctttgtacacgttgccgaatcctccaaccccgatgataaaaatatcttcgaagttgtttgtagcggc |
4712671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University