View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14923_high_6 (Length: 282)
Name: NF14923_high_6
Description: NF14923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14923_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 42 - 260
Target Start/End: Original strand, 35189544 - 35189762
Alignment:
| Q |
42 |
atacagaacaatccaactgtctagtaatagtatggttaaaatatttgaagaatgaaagattggcttacctgagagagacgaggttagtgcaaggagctaa |
141 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35189544 |
atacagcacaatccaactgtctagtaattgtatggttaaaatatttgaagaatgaaagattggcttacctgagagagacgaggttagtgcaaggagctaa |
35189643 |
T |
|
| Q |
142 |
aatggtgagaaagatagagaaaacatattcacggtcagtgtaaaacaaagtgatatccagttcatgtagacaagacccagtggcgctacgaatccacgag |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35189644 |
aatggtgagaaagatagagaaaacatattcacggtcagtgtaaaacaaagtgatatccagttcctgtagacaagagccagtggcgctacgaatccacgag |
35189743 |
T |
|
| Q |
242 |
tcaatagagttgtagaaga |
260 |
Q |
| |
|
|||||||||||| |||||| |
|
|
| T |
35189744 |
tcaatagagttggagaaga |
35189762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University