View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14924_high_17 (Length: 310)
Name: NF14924_high_17
Description: NF14924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14924_high_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 71 - 294
Target Start/End: Complemental strand, 11464975 - 11464752
Alignment:
| Q |
71 |
ttgtttatgtttatgtgatgggtggggtaacatcatcaatggcatcaaaatttgcattctttccaccaaacccaccatcatacaagctaatcaaagatga |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11464975 |
ttgtttatgtttatgtgatgggtggggtaacatcatcaatggcatcaaaatttgcattctttccaccaaacccaccatcatacaaactaatcaaagatga |
11464876 |
T |
|
| Q |
171 |
tttaacaggtctacttctgttaacaccatttcctcaccgtgaaaacgttgaaattatgaaactttcgacacgtcgaggaacggagattgtggctgtttat |
270 |
Q |
| |
|
|||||||||||| ||||| ||||||| | ||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11464875 |
tttaacaggtcttcttctactaacaccttatcctcaccgtgaaaacgttgagattatgaaactttcgacgcgtcgaggaacggagattgtggctgtttat |
11464776 |
T |
|
| Q |
271 |
gttcgtcatccaatggctacttca |
294 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
11464775 |
gttcgtcatccaatggctacttca |
11464752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 103 - 167
Target Start/End: Complemental strand, 34325519 - 34325455
Alignment:
| Q |
103 |
tcatcaatggcatcaaaatttgcattctttccaccaaacccaccatcatacaagctaatcaaaga |
167 |
Q |
| |
|
|||||||||||| | ||||| |||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
34325519 |
tcatcaatggcagcgaaattagcattctttccaccaaacccaccatcatacaaactcatcaaaga |
34325455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University