View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14924_high_29 (Length: 248)
Name: NF14924_high_29
Description: NF14924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14924_high_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 77 - 232
Target Start/End: Complemental strand, 2676689 - 2676537
Alignment:
| Q |
77 |
ttcctatttccttttgatgtgctaatatcatcttatgggaaggattttccttgattgataaaatgtattttcactatcattcnnnnnnnnnnaacaaaat |
176 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2676689 |
ttcctatttccttt-gatgtgctaatatcatcttatgggaaggattttccttgattgataaaatgtattttcactatcatt-tctttttttaaacaaaa- |
2676593 |
T |
|
| Q |
177 |
tatcactatcaagttatgtaaagaagttacagtaattacatggtctgtgactactg |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
2676592 |
tatcactatcaagttatgtaaagaagttacaataattacatggtgtgtgactactg |
2676537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 2678322 - 2678277
Alignment:
| Q |
1 |
ctaaaaatctataataaaccgattagacatccaaaataaaaaactt |
46 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2678322 |
ctaaaaatttataataaaccgattagacatccaaaataaaaaactt |
2678277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University