View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14924_low_13 (Length: 388)
Name: NF14924_low_13
Description: NF14924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14924_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 140 - 364
Target Start/End: Original strand, 2678475 - 2678699
Alignment:
| Q |
140 |
aaaaacacattgacagtcaacccgtccatccgacataaagcatggtcggttgatagtttgaatcctacatttttaattagccgctccaccccttgttaga |
239 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2678475 |
aaaaacacattgacactcaacccgtccatccgacataaagcatggtgggttgatagtttgaatcctacatttttaattagccattccaccccttgttaga |
2678574 |
T |
 |
| Q |
240 |
gtggttaatgacaagatgggacgggcaggccatttttccatccatagtttaaacctaatttcactacctcatatttataatgttttaatttaattcatat |
339 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2678575 |
gtggttaatgacaggatgggacgggcaggccatttttccgtccatagtttaaacctaacttcactacctcatatttataatgttttaatttaattcatat |
2678674 |
T |
 |
| Q |
340 |
aaattgttttgtttgaattcaaatt |
364 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
2678675 |
aaattgttttgtttgaattcaaatt |
2678699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 2 - 50
Target Start/End: Original strand, 2678336 - 2678384
Alignment:
| Q |
2 |
tatgtttgaatgataatttttatattttttatggagccatttgttatct |
50 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
2678336 |
tatgtttgaatgataatttttatatttttgatggagtcatttgttatct |
2678384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University