View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14924_low_23 (Length: 288)
Name: NF14924_low_23
Description: NF14924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14924_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 18 - 273
Target Start/End: Complemental strand, 47288824 - 47288571
Alignment:
| Q |
18 |
gtaataacaatttatttttaagaacccgcctaaggcgctaaagtacttcaaatttgccgccaaatgggaaggatttactgattaaatacttacccattgc |
117 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
47288824 |
gtaataacaaattatttttaagaacccgcctaaggcgctaaagtacttcaaatttgccgccaaatgggaaggaattactgattgaatacttacccattgc |
47288725 |
T |
 |
| Q |
118 |
ttaacaattatgcagatgatcccaaacacatcacatcccaaaaataaatgattcatactttcttgtaaaccccgaccgatgaacacacacattcaatgtt |
217 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47288724 |
tt--caattatgcagatgatcccaaacacatcacatcccaaaaataaatgattcatactttcttgtaaaccccgaccaatgaacacacacattcaatgtt |
47288627 |
T |
 |
| Q |
218 |
tctggaataattccaagcttctcccccaatcttccaggctaaagcatacatctctg |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47288626 |
tctggaataattccaagcttctcccccaatcttccaggctaaagcatacatctctg |
47288571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 79 - 166
Target Start/End: Original strand, 11193409 - 11193496
Alignment:
| Q |
79 |
aaatgggaaggatttactgattaaatacttacccattgcttaacaattatgcagatgatcccaaacacatcacatcccaaaaataaat |
166 |
Q |
| |
|
|||||||||||||||||||||| |||| | ||||||||||| | ||| || ||| ||| |||||| |||||| |||||||||||| |
|
|
| T |
11193409 |
aaatgggaaggatttactgattgaatatcaagtcattgcttaaccaatattcaaatgctccaaaacacgtcacattccaaaaataaat |
11193496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University