View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14924_low_24 (Length: 286)
Name: NF14924_low_24
Description: NF14924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14924_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 114; Significance: 7e-58; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 20 - 181
Target Start/End: Original strand, 34447651 - 34447812
Alignment:
| Q |
20 |
tagatgtgtaaacgtccccaaacatataaagaaacctagtcaagttcaaactgtggcattacagattgagttaccaatacaataataaaaccattcacag |
119 |
Q |
| |
|
||||||||||||| ||||||| ||| |||| ||| ||||||||||||||||||| |||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34447651 |
tagatgtgtaaacatccccaatcatctaaacaaaactagtcaagttcaaactgtagcattacaaattgagttaccgatacaataataaaaccattcacag |
34447750 |
T |
|
| Q |
120 |
ttaaaccaaatgtaatagtacaaaggttatttatatttcgaattgtggcattatagtttgaa |
181 |
Q |
| |
|
||||| |||||| |||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
34447751 |
ttaaatcaaatgcaatagtacaaaggtaatttatatttcaaattgtggcattatagtttgaa |
34447812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 173 - 273
Target Start/End: Original strand, 34448224 - 34448324
Alignment:
| Q |
173 |
tagtttgaattatcaatacaacaataaaaacgattcacgatcaaggaaaaacagattgattaacatgtaaaatagccacttattataactgatcttgctt |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34448224 |
tagtttgaattatcaatacaacaataaaaacgattcacgatcaaggaaaaacagaaggattaaaatgtaaaatagccacttattataactgatcttgctt |
34448323 |
T |
|
| Q |
273 |
c |
273 |
Q |
| |
|
| |
|
|
| T |
34448324 |
c |
34448324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 241 - 273
Target Start/End: Original strand, 34459525 - 34459557
Alignment:
| Q |
241 |
aaaatagccacttattataactgatcttgcttc |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34459525 |
aaaatagccacttattataactgatcttgcttc |
34459557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University