View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14924_low_27 (Length: 264)
Name: NF14924_low_27
Description: NF14924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14924_low_27 |
 |  |
|
| [»] scaffold0043 (4 HSPs) |
 |  |  |
|
| [»] scaffold1163 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0043 (Bit Score: 226; Significance: 1e-124; HSPs: 4)
Name: scaffold0043
Description:
Target: scaffold0043; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 28986 - 28737
Alignment:
| Q |
1 |
atttggactctttgctagatacaagatggtcaagatctgatgatgagtccaacaatgtaaaggaaatttacaatccatgcaaaagagaaatcaatttcag |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28986 |
atttggactctttgttagatacaagatggtcaagatctgatgatgagtccaacaaagtaaaggaaatttacaatccatgcaaaagagaaatcaatttcag |
28887 |
T |
 |
| Q |
101 |
cgtatgcaactcaagtgcaatgacatgattcttaactggattattgccaagatcattttacgcaagcaagaaaattttggtaggattgatgatcttgact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28886 |
cgtatgcaactcaagtgcaatgacatgattcttcacttgattattgccaagatcattctacgcatgcaagaaaattttggtaggattgatgatcttgact |
28787 |
T |
 |
| Q |
201 |
taaggttaatgtggctgatcaagaatagaaccttagtcaattggcctttg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28786 |
taaggttaatgtggctgatcaagaatagaaccttagtcaattggcctttg |
28737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0043; HSP #2
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 43844 - 43595
Alignment:
| Q |
1 |
atttggactctttgctagatacaagatggtcaagatctgatgatgagtccaacaatgtaaaggaaatttacaatccatgcaaaagagaaatcaatttcag |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43844 |
atttggactctttgttagatacaagatggtcaagatctgatgatgagtccaacaaagtaaaggaaatttacaatccatgcaaaagagaaatcaatttcag |
43745 |
T |
 |
| Q |
101 |
cgtatgcaactcaagtgcaatgacatgattcttaactggattattgccaagatcattttacgcaagcaagaaaattttggtaggattgatgatcttgact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43744 |
cgtatgcaactcaagtgcaatgacatgattcttcacttgattattgccaagatcattctacgcatgcaagaaaattttggtaggattgatgatcttgact |
43645 |
T |
 |
| Q |
201 |
taaggttaatgtggctgatcaagaatagaaccttagtcaattggcctttg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43644 |
taaggttaatgtggctgatcaagaatagaaccttagtcaattggcctttg |
43595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0043; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 71 - 99
Target Start/End: Complemental strand, 29015 - 28987
Alignment:
| Q |
71 |
caatccatgcaaaagagaaatcaatttca |
99 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29015 |
caatccatgcaaaagagaaatcaatttca |
28987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0043; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 71 - 99
Target Start/End: Complemental strand, 43873 - 43845
Alignment:
| Q |
71 |
caatccatgcaaaagagaaatcaatttca |
99 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43873 |
caatccatgcaaaagagaaatcaatttca |
43845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 142 - 247
Target Start/End: Original strand, 22668379 - 22668484
Alignment:
| Q |
142 |
tattgccaagatcattttacgcaagcaagaaaattttggtaggattgatgatcttgacttaaggttaatgtggctgatcaagaatagaaccttagtcaat |
241 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
22668379 |
tattgccaggatcattttatgcaagcaagaaaattttggtaggattgatgatcttgacttaaggttaatgtggttgatcaagaatagaactttagtcaat |
22668478 |
T |
 |
| Q |
242 |
tggcct |
247 |
Q |
| |
|
|||||| |
|
|
| T |
22668479 |
tggcct |
22668484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 22395294 - 22395240
Alignment:
| Q |
1 |
atttggactctttgctagatacaagatggtcaagatctgatgatgagtccaacaa |
55 |
Q |
| |
|
|||||||||||| | |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22395294 |
atttggactcttggtcagatacaagatggtcaaggtctgatgatgagtccaacaa |
22395240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1163 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: scaffold1163
Description:
Target: scaffold1163; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 698 - 644
Alignment:
| Q |
1 |
atttggactctttgctagatacaagatggtcaagatctgatgatgagtccaacaa |
55 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
698 |
atttggactctttgttagatacaagatggtcaaggtctgatgatgagtccaacaa |
644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 6e-18; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 27388341 - 27388395
Alignment:
| Q |
1 |
atttggactctttgctagatacaagatggtcaagatctgatgatgagtccaacaa |
55 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27388341 |
atttggactctttgttagatacaagatggtcaaggtctgatgatgagtccaacaa |
27388395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 27980756 - 27980706
Alignment:
| Q |
1 |
atttggactctttgctagatacaagatggtcaagatctgatgatgagtcca |
51 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27980756 |
atttggactcttggttagatacaagatggtcaaggtctgatgatgagtcca |
27980706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 28006262 - 28006212
Alignment:
| Q |
1 |
atttggactctttgctagatacaagatggtcaagatctgatgatgagtcca |
51 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28006262 |
atttggactcttggttagatacaagatggtcaaggtctgatgatgagtcca |
28006212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 28085384 - 28085334
Alignment:
| Q |
1 |
atttggactctttgctagatacaagatggtcaagatctgatgatgagtcca |
51 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28085384 |
atttggactcttggttagatacaagatggtcaaggtctgatgatgagtcca |
28085334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 26631073 - 26631022
Alignment:
| Q |
1 |
atttggactctttgctagatacaagatggtcaagatctgatgatgagtccaa |
52 |
Q |
| |
|
|||||||||||| | |||||||||||| |||||| ||||| ||||||||||| |
|
|
| T |
26631073 |
atttggactcttggttagatacaagatcgtcaaggtctgacgatgagtccaa |
26631022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 6164667 - 6164702
Alignment:
| Q |
16 |
tagatacaagatggtcaagatctgatgatgagtcca |
51 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6164667 |
tagatacaagatggtcaaggtctgatgatgagtcca |
6164702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 6164108 - 6164058
Alignment:
| Q |
1 |
atttggactctttgctagatacaagatggtcaagatctgatgatgagtcca |
51 |
Q |
| |
|
|||||||||| | | |||||| |||||||||||| |||||||||||||||| |
|
|
| T |
6164108 |
atttggactcgtggttagatataagatggtcaaggtctgatgatgagtcca |
6164058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University