View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14924_low_32 (Length: 252)
Name: NF14924_low_32
Description: NF14924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14924_low_32 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 64 - 252
Target Start/End: Original strand, 1052269 - 1052458
Alignment:
| Q |
64 |
catccatcaatttagtcgagatgcacatgagtggatcactagtctagtaacaacgtgtttctccttgaacaacatgagccaaacttattatgaataatgt |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1052269 |
catccatcaatttagtcgagatgcacatgagtggatcactagtctagtaacaacgtgttactccttgaacaacatgagccaaacttattatgaataatgt |
1052368 |
T |
 |
| Q |
164 |
taggaacatatatccaat-atatttttcatttatcggttgaaatttatgtggctcccaccaaattatgtaggtccaatataaatttcgtg |
252 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
1052369 |
taggaacatatatccaataaaatttttcatttatcggttgaaatttatgtggctcccaccaaattatgctggtctaatataaatttcgtg |
1052458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 15 - 65
Target Start/End: Original strand, 1052174 - 1052224
Alignment:
| Q |
15 |
aaaattcaccacaaaagtatttatgtaaatcaccatatctaaaggataaca |
65 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1052174 |
aaaatccaccacaaaagtatttatataaatcaccatatctaaaggataaca |
1052224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University