View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14924_low_34 (Length: 250)
Name: NF14924_low_34
Description: NF14924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14924_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 4 - 234
Target Start/End: Original strand, 46108170 - 46108401
Alignment:
| Q |
4 |
aaatttaggatgataaatttgtggaaatcaaaatcaggagaaccaactagcaagcaatacgtaacatgtcaactgcaattagttcaataagtagggctta |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46108170 |
aaatttaggatgataaatttgtggaaatcaaaatcaggagaaccaactagcaagcaatacgtaacatgtcaactgcaattagttcaataagtagggctta |
46108269 |
T |
 |
| Q |
104 |
aatgataaaaggttgttggtatttgatatggtgaagtgaaggttaaagtctgttatcctgg-nnnnnnnnnnnnnggtacaaaagtttttgtgcaagatt |
202 |
Q |
| |
|
||| |||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46108270 |
aattataaaaggttattggtatttgatatgatgaagtgaaggttaaagtctgttatcctggtttttattttttttggtacaaaagtttttgtgcaagatt |
46108369 |
T |
 |
| Q |
203 |
tgccctacttcaatgttaattaaactattttc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
46108370 |
tgccctacttcaatgttaattaaactattttc |
46108401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University