View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14924_low_4 (Length: 564)
Name: NF14924_low_4
Description: NF14924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14924_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 263; Significance: 1e-146; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 18 - 284
Target Start/End: Original strand, 56012349 - 56012615
Alignment:
| Q |
18 |
acttattggtgctggtggtggcccaccgtaaccttcaaagcatggcccacctcccctaccttcatagcatggcgtacaacacactccaattggaactgcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56012349 |
acttattggtgctggtggtggcccaccgtaaccttcaaagcatggcccacctcccctaccttcatagcatggcgtacaacacactccaattggaactgcc |
56012448 |
T |
|
| Q |
118 |
ataggtggtggacacaccggaatataaggtgccggttccggcataggctgcggtggcggagcgggtttttcttttggcttctcaggttgttttggtggtt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56012449 |
ataggtggtggacacaccggaatataaggtgccggttccggcataggctgcggtggcggagcgggtttttcttttggcttctcaggttgttttggtggtt |
56012548 |
T |
|
| Q |
218 |
caggcttcggctcaggtggtggaggtgcaggcttttctttgggtttctcaggctctttaggcttttc |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
56012549 |
caggcttcggctcaggtggtggaggtgcaggcttttctttgggtttctcaggctctttgggcttttc |
56012615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 161; E-Value: 1e-85
Query Start/End: Original strand, 391 - 551
Target Start/End: Original strand, 56012722 - 56012882
Alignment:
| Q |
391 |
acgggttccttgggcttttctggttctttaggcttgggaggtggaggaggttcgacaatttctatgcttttgatggcaccacaacctttgcaacaaatct |
490 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56012722 |
acgggttccttgggcttttctggttctttaggcttgggaggtggaggaggttcgacaatttctatgcttttgatggcaccacaacctttgcaacaaatct |
56012821 |
T |
|
| Q |
491 |
tgtctcttatcttctcggggctacaacaaaccactgtgattgtcacgatgttgttcttctc |
551 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56012822 |
tgtctcttatcttctcggggctacaacaaaccactgtgattgtcacgatgttgttcttctc |
56012882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 439 - 525
Target Start/End: Complemental strand, 19923853 - 19923767
Alignment:
| Q |
439 |
ggttcgacaatttctatgcttttgatggcaccacaacctttgcaacaaatcttgtctcttatcttctcggggctacaacaaaccact |
525 |
Q |
| |
|
||||| || ||||||||||||||||||| ||||| |||| |||||||| |||||||||| |||||| ||||| || || |||||| |
|
|
| T |
19923853 |
ggttcaactatttctatgcttttgatggtaccacccccttgacaacaaatattgtctcttaccttctctgggctgcagcacaccact |
19923767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 448 - 542
Target Start/End: Original strand, 9687542 - 9687636
Alignment:
| Q |
448 |
atttctatgcttttgatggcaccacaacctttgcaacaaatcttgtctcttatcttctcggggctacaacaaaccactgtgattgtcacgatgtt |
542 |
Q |
| |
|
||||| ||||| ||||| | ||| | ||||||| |||||| |||||| || |||||||| || |||||||| ||||| ||||||||||| ||||| |
|
|
| T |
9687542 |
atttcaatgctcttgatagaacctccacctttgtaacaaagcttgtccctaatcttctcaggactacaacacaccaccgtgattgtcacaatgtt |
9687636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University