View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14924_low_43 (Length: 208)
Name: NF14924_low_43
Description: NF14924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14924_low_43 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 30436289 - 30436098
Alignment:
| Q |
1 |
atttttatcgtcgtgtttatgtaaaacggacatgaattaattttatcattacaatttgcaacttgataaaagagcagaagcaataaaacacaagtagaat |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
30436289 |
atttttatcgtcatgtttatgtaaaacgggcatgaactaattttatcattacaatttgcaacttgataaaagagcagaagcgaaaaaacacaagtagaat |
30436190 |
T |
|
| Q |
101 |
atcagatttaaggatatgaacatgcgtaccagaaatttaatatgctgacagggatccagaacctaaaacctgaacagacaaatcacacagaa |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30436189 |
atcagatttaaggatatgaacatgcgtaccagaaatttaatacactgacagggatccagaacctaaaacctgaacagacaaatcacacagaa |
30436098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University