View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14924_low_44 (Length: 206)
Name: NF14924_low_44
Description: NF14924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14924_low_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 7e-48; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 11 - 119
Target Start/End: Complemental strand, 7990545 - 7990437
Alignment:
| Q |
11 |
atcatcatttcacaaatcgattttgtaaggttgtattagactcaaacataatttctaaaagtgccttaaagcactcgttaccatttcttttaaaaatttc |
110 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7990545 |
atcatcatttcactaatcgattttgtaaggttgtattagactcaaccataatttctaagagtgccttaaagcactcgttaccatttcttttaaaaatttc |
7990446 |
T |
 |
| Q |
111 |
ttaaccatg |
119 |
Q |
| |
|
||||||||| |
|
|
| T |
7990445 |
ttaaccatg |
7990437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 20 - 68
Target Start/End: Complemental strand, 42985172 - 42985124
Alignment:
| Q |
20 |
tcacaaatcgattttgtaaggttgtattagactcaaacataatttctaa |
68 |
Q |
| |
|
|||||| |||||||||| ||||||| |||||||||| |||||||||||| |
|
|
| T |
42985172 |
tcacaagtcgattttgtgaggttgtgttagactcaaccataatttctaa |
42985124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 116 - 192
Target Start/End: Complemental strand, 25847915 - 25847839
Alignment:
| Q |
116 |
catgtatacatttttctgggaacaacaaaagcaaagacaatttctcactagccaccaccactcactgaacctctctg |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25847915 |
catgtatacatttttctgggaacaacaaaagcaacgacaatttctcactagccaccaccactcactgaacctctctg |
25847839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University