View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14925_high_8 (Length: 209)
Name: NF14925_high_8
Description: NF14925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14925_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 7e-82; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 18 - 192
Target Start/End: Original strand, 5375897 - 5376075
Alignment:
| Q |
18 |
atactctagatgattatataaatgcatgaaatttgcgtttgtatccgaacccacatgctcatatctcatatcaccttctggacacgatatcaatcacttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5375897 |
atactctagatgattatataaatgcatgaaatttgcatttgtatccgaacccacatgctcatatctcatatcaccttctggacacgatatcaatcacttt |
5375996 |
T |
 |
| Q |
118 |
gt----ttacaatactgagtatgctcaagcatgcattctttacgttgtttaatgccaatctttcaaatgttgcaggacc |
192 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5375997 |
gtttaattacaatactgagtatgctcaagcatgcattctttgcgttgtttaatgccaatctttcaaatgttgcaggacc |
5376075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 18 - 192
Target Start/End: Complemental strand, 5368721 - 5368559
Alignment:
| Q |
18 |
atactctagatgattatataaatgcatgaaatttgcgtttgtat---ccgaacc--cacatgctcatatctcatatcaccttctggacacgatatcaatc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |||| ||| | ||||| || |||||||||| |||| ||| ||| |||| ||||||||||| |
|
|
| T |
5368721 |
atactctagatgattatataaatgcatgtaatttgtgtttttatatgctgaacctgcatatgctcatatgtcat--cacattcaggacgcgatatcaatc |
5368624 |
T |
 |
| Q |
113 |
actttgtttacaatactgagtatgctcaagcatgcattctttacgttgtttaatgccaatctttcaaatgttgcaggacc |
192 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5368623 |
actttgttttcaatat---------------atgcattctttacgttgtttaatgccaatctttcaaatgttgcaggacc |
5368559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University