View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14925_low_10 (Length: 240)
Name: NF14925_low_10
Description: NF14925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14925_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 58 - 139
Target Start/End: Complemental strand, 32892309 - 32892228
Alignment:
| Q |
58 |
ggtttctttggctagagctggaattttgttgttgtgggtcatgttagtttttgctcttatagtaacattgtttttcgccatt |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32892309 |
ggtttctttggctagagctggaattttgttgttgtgggtcatgttagtttttgctcttatagtaacattgtttttctccatt |
32892228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 174 - 225
Target Start/End: Complemental strand, 32892196 - 32892145
Alignment:
| Q |
174 |
accattcaaatattcggttactcagacaacgtactttcaacaaagcattact |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32892196 |
accattcaaatattcggttactcagacaacgtactttcaacaaagcattact |
32892145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University