View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14925_low_10 (Length: 240)

Name: NF14925_low_10
Description: NF14925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14925_low_10
NF14925_low_10
[»] chr4 (2 HSPs)
chr4 (58-139)||(32892228-32892309)
chr4 (174-225)||(32892145-32892196)


Alignment Details
Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 58 - 139
Target Start/End: Complemental strand, 32892309 - 32892228
Alignment:
58 ggtttctttggctagagctggaattttgttgttgtgggtcatgttagtttttgctcttatagtaacattgtttttcgccatt 139  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
32892309 ggtttctttggctagagctggaattttgttgttgtgggtcatgttagtttttgctcttatagtaacattgtttttctccatt 32892228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 174 - 225
Target Start/End: Complemental strand, 32892196 - 32892145
Alignment:
174 accattcaaatattcggttactcagacaacgtactttcaacaaagcattact 225  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
32892196 accattcaaatattcggttactcagacaacgtactttcaacaaagcattact 32892145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University