View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14925_low_7 (Length: 314)
Name: NF14925_low_7
Description: NF14925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14925_low_7 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 1 - 314
Target Start/End: Complemental strand, 43867216 - 43866903
Alignment:
| Q |
1 |
acgccaccatctgcgccgtcgccacccgcaactacaacaaagccgccgctttcgccgccgccaatggcttcccactaacagcgaaggtgtacgggaacta |
100 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43867216 |
acgccaccatctgcgccgtcgctagccgcaactacgacaaagccgccgctttcgccgccgccaatggctacccactaacagcgaaggtgtacgggaacta |
43867117 |
T |
|
| Q |
101 |
cgaagctctgctggacgaccctgatgtggacgctgtgtatatgccacttcctacaagcttgcaccttaagtgggccgttcttgcggcccagaataagaag |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43867116 |
cgaagctctgctggaagaccctgatgtggacgctgtgtatatgccacttcctacaagcttgcaccttaagtgggccgttcttgcggcccagaataagaag |
43867017 |
T |
|
| Q |
201 |
catttgcttcttgagaagcctgttgcgctggatattgttgagtttgatgaaattgtgggagcttgtgaggagaatggtgtgcagtttatggataatacta |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43867016 |
catttgcttcttgagaagcctgttgcgctggatattgctgagtttgatgaaattgtgggagcttgcgaggagaatggtgtgcagtttatggataatacta |
43866917 |
T |
|
| Q |
301 |
tgtgggttcataat |
314 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
43866916 |
tgtgggttcataat |
43866903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University