View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14926_high_3 (Length: 236)
Name: NF14926_high_3
Description: NF14926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14926_high_3 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 8 - 236
Target Start/End: Complemental strand, 8893149 - 8892921
Alignment:
| Q |
8 |
atatgaaccgtatgaaatgttgcattgaatgcaaacattttgaactcaaattcttaatttcaaacatgcaaaatagagtatgaattttggttcatgtaat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8893149 |
atatgaaccgtatgaaatgttgcattgaatgcaaacattttgaactcaaattcttaatttcaaacatgcaaaatagagtatgaattttggttcatgtaat |
8893050 |
T |
|
| Q |
108 |
tggaaaatatgccatcgaataatttggatcattcgattatgatcaagtttaatattttgtatctaagtaggaacacgaaccgtctagttataagatccag |
207 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8893049 |
tggaaaatatgcaatcgaataatttggatcattcgattatgatcaaatttaatattttgtatctaagtaggaacacgaatcgtctagttataagatccag |
8892950 |
T |
|
| Q |
208 |
tgatctgaattgcatgattataattgtgt |
236 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8892949 |
tgatctgaattgcatgattataattgtgt |
8892921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University