View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14926_low_3 (Length: 320)
Name: NF14926_low_3
Description: NF14926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14926_low_3 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 79 - 320
Target Start/End: Complemental strand, 19430076 - 19429835
Alignment:
| Q |
79 |
agaagcaaactcacaattcaaaacagcacaagtacgaggattgtcaccagagtagtatcattcgacataattggagaatatcatttatttatacaataag |
178 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19430076 |
agaagcaaattcacaattcaaaaaagcacaagtacgaggattgtcaccagagtagtatcattcgacataattggagaatatcatttattaatacaataag |
19429977 |
T |
|
| Q |
179 |
catcgctccttataccataaactgcaaactcatacttcatttgtttatgaaatgtttgtctgaagcaatgcttgtaactacaatacaaaacattctcaaa |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19429976 |
catcgctccttataccataaactgcaaactcatacttcatttgtttatgaaatgtatgtatgaagcaatgcttgtaactacaatacaaaacattctcaaa |
19429877 |
T |
|
| Q |
279 |
gacacaatccttaaccacattaaacaatgctccaatttaaaa |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19429876 |
gacacaatccttaaccacattaaacaatgctccaatttaaaa |
19429835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University