View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14927_high_24 (Length: 289)
Name: NF14927_high_24
Description: NF14927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14927_high_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 7e-89; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 99 - 272
Target Start/End: Original strand, 48910379 - 48910552
Alignment:
| Q |
99 |
cttgtttgaatgaagatgatgttaaatgtttaatacagcagctaatgataataattttttcctttgggaggagcaaatagcagtttgataactttccata |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48910379 |
cttgtttgaatgaagatgatgttaaatgtttaatacagcagctaatgataataattttttcctttgggaggagcaaatagcagtttgataactttccata |
48910478 |
T |
 |
| Q |
199 |
gtttctacaaacgtcattccaattcacaagttacaatacatgaaagaaaattgctattacccacaaccaatact |
272 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
48910479 |
gtttctacaaacatcattccaattcacaagttacaatacatgaaagaatattgctattacccacaaccaatact |
48910552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 11 - 59
Target Start/End: Original strand, 48910291 - 48910339
Alignment:
| Q |
11 |
cacagaggtagaagctggttatacttataaaaagtaggataacatgatc |
59 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
48910291 |
cacaaaggtagaagcgggttatacttataaaaagtaggataacatgatc |
48910339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University