View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14927_high_34 (Length: 252)
Name: NF14927_high_34
Description: NF14927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14927_high_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 28308466 - 28308675
Alignment:
| Q |
1 |
aatgaggttgatatttgtcatttgattctaagatgcatatttaaatataa-ttttttatagtatatttaagaaaacaacaatgccagagtg------ctc |
93 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
28308466 |
aatgagattgatatttgtcatttgattctaagatgcatatttaaatataatttttttatagtatatttaagaaaacaacaatgccagagtgctcatactc |
28308565 |
T |
 |
| Q |
94 |
atagtctgcaaatcagtagcacatgcgaat-gggcactttccacgtgatccattcaaatggaatctactatatatatattcgggccatgctatgctatgt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
28308566 |
atagtctgcaaatcagtagcacatgcgaatggggcactttccacgtgatccattcaaatggaatcta----ttatatatccgggccatgctatgctatgt |
28308661 |
T |
 |
| Q |
193 |
tcacattgggattc |
206 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
28308662 |
tcacattgggattc |
28308675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University