View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14927_high_41 (Length: 226)
Name: NF14927_high_41
Description: NF14927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14927_high_41 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 104
Target Start/End: Original strand, 43867249 - 43867352
Alignment:
| Q |
1 |
cgagctatgtcggcacagcctactactccgatttggatcagtgcttctgacattttagtcaacgcgaattgaagatagagattgactgagtgagtgtggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43867249 |
cgagctatgtcggcacagcctactactccgatttggatcagtgcttctgacattttggtcaacgcgaattgaagatagagatggactgagtgagtgtggt |
43867348 |
T |
|
| Q |
101 |
gtcg |
104 |
Q |
| |
|
|||| |
|
|
| T |
43867349 |
gtcg |
43867352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 157 - 194
Target Start/End: Original strand, 43867367 - 43867404
Alignment:
| Q |
157 |
tatactagtactagtgtagcctttacaacacaaatatt |
194 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
43867367 |
tatactagtactagtataacctttacaacacaaatatt |
43867404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University