View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14927_low_29 (Length: 292)
Name: NF14927_low_29
Description: NF14927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14927_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 1e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 127 - 279
Target Start/End: Original strand, 52725838 - 52725990
Alignment:
| Q |
127 |
agagggtaaacgagaacaaggtagagattgttagttatagatttcattattgtctttttcaccaaaattcacttggagagacatggagaccactttacct |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
52725838 |
agagggtaaacgagaacaaggtagagattgttagttatagatttcattattgtctttttcaccaaaattcacttggagagaaatggagaccactttacct |
52725937 |
T |
 |
| Q |
227 |
atgtctcaaattcattgaattcctcttgaacaaaataaagaagaagatatatg |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52725938 |
atgtctcaaattcattgaattcctcttgaacaaaataaagaagaagatatatg |
52725990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University