View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14927_low_31 (Length: 286)
Name: NF14927_low_31
Description: NF14927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14927_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 19 - 275
Target Start/End: Complemental strand, 16285799 - 16285546
Alignment:
| Q |
19 |
tttaaatcttcatgggttctataacaaacacatgagtcatttagttagcaagacacttcagttattgatgtgctagatctggttttgggatttactattt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
16285799 |
tttaaatcttcatgggttctataacaaacacatgagtcatttagttagcaagacacttcagttattgatgtgctagatctggttttgggattta---ttt |
16285703 |
T |
 |
| Q |
119 |
atgattgaattatttcaccgtgtttaaagggagacttaatcattttccaagagttattattaccaacatttatggtcgatgaccatattattatggccac |
218 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16285702 |
atgattgaattatctcaccgtgtttaaagggacacttaatcattttccaagagttattattaccaacatttatggtcgatgaccatattattatggccac |
16285603 |
T |
 |
| Q |
219 |
tgctttatttgactttgaccaaattcaattcgcgcgggatccaacccatacgttcat |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16285602 |
tgctttatttgactttgaccaaattcaattcgcgcgggatccaacccatacgttcat |
16285546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University