View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14927_low_36 (Length: 270)
Name: NF14927_low_36
Description: NF14927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14927_low_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 7 - 252
Target Start/End: Original strand, 43129181 - 43129425
Alignment:
| Q |
7 |
tagattattctcactttcattgccttcaaaatggagcccttagaattgttggcttagtaagtccactccatgggtaaatttatcccagctggcagtgaag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43129181 |
tagattattctcactttcattgccttcaaaatggagcc-ttagaattgttggcttagtaagtccactccatgggtaaatttatcccagctggcagtgaag |
43129279 |
T |
 |
| Q |
107 |
gatcgtagcattcctcctccttcttcaccttcactgagccaccattcttcccttttgagcccnnnnnnnnnnnnnnnnnctgagccttcgttgagccttc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43129280 |
gatcgtagcattcctcctccttcttcaccttcactgagccaccattcttcccttttgagccctttttcttttttcttttctgagccttcgttgagccttc |
43129379 |
T |
 |
| Q |
207 |
atggacagcatttttgttgttgtctttgttacttcgattctgatag |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43129380 |
atggacagcatttttgttgttgtctttgttactttcattctgatag |
43129425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 53 - 165
Target Start/End: Original strand, 43139484 - 43139595
Alignment:
| Q |
53 |
tgttggcttagtaagtccactccatgggtaaatttatcccagctggcagtgaaggatcgtagcattcctcctccttcttcaccttcactgagccaccatt |
152 |
Q |
| |
|
|||||| |||||||||||||||| |||||||| ||| |||| ||||| ||| |||| | |||||||||| ||| ||||||||| ||||| ||||||| |
|
|
| T |
43139484 |
tgttggattagtaagtccactccgtgggtaaaactattccaggaggcagagaatgatcatgacattcctccttctt-ttcaccttctctgagtcaccatt |
43139582 |
T |
 |
| Q |
153 |
cttcccttttgag |
165 |
Q |
| |
|
||||||||||||| |
|
|
| T |
43139583 |
cttcccttttgag |
43139595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University