View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14927_low_47 (Length: 226)

Name: NF14927_low_47
Description: NF14927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14927_low_47
NF14927_low_47
[»] chr1 (2 HSPs)
chr1 (1-104)||(43867249-43867352)
chr1 (157-194)||(43867367-43867404)


Alignment Details
Target: chr1 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 104
Target Start/End: Original strand, 43867249 - 43867352
Alignment:
1 cgagctatgtcggcacagcctactactccgatttggatcagtgcttctgacattttagtcaacgcgaattgaagatagagattgactgagtgagtgtggt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||    
43867249 cgagctatgtcggcacagcctactactccgatttggatcagtgcttctgacattttggtcaacgcgaattgaagatagagatggactgagtgagtgtggt 43867348  T
101 gtcg 104  Q
    ||||    
43867349 gtcg 43867352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 157 - 194
Target Start/End: Original strand, 43867367 - 43867404
Alignment:
157 tatactagtactagtgtagcctttacaacacaaatatt 194  Q
    ||||||||||||||| || |||||||||||||||||||    
43867367 tatactagtactagtataacctttacaacacaaatatt 43867404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University