View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14927_low_49 (Length: 206)
Name: NF14927_low_49
Description: NF14927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14927_low_49 |
 | |
|
| [»] scaffold0018 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0018 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 189
Target Start/End: Complemental strand, 186426 - 186255
Alignment:
| Q |
18 |
aagtataaatttaaagaagatagattatagttatagatgatattagtgaccttgatcaatggattgcatagccatttgtgcatagtttgctacccctcca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
186426 |
aagtataaatttaaagaagatagattatagttatagatgatattagtgaccttgatcaatggattgcatagccatttgtgcatagtttgctacccctcca |
186327 |
T |
|
| Q |
118 |
gaaaagtctagcagaatgttccaaatgctccatccatcagtactttttctcataaagttcatcaccgcctat |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
186326 |
gaaaagtctagcagaatgttccaaatgctccatccatcagtactttttctcataaagttcatcaccgcctat |
186255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018; HSP #2
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 66 - 164
Target Start/End: Original strand, 189504 - 189602
Alignment:
| Q |
66 |
accttgatcaatggattgcatagccatttgtgcatagtttgctacccctccagaaaagtctagcagaatgttccaaatgctccatccatcagtactttt |
164 |
Q |
| |
|
||||||||| | ||||||| | |||| ||| |||||||||||| ||||||||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
189504 |
accttgatctactgattgcacaaccatctgtccatagtttgctattcctccagaaaagtctagtagaatgttcccaatgctccatccatcagtactttt |
189602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University