View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14927_low_52 (Length: 201)
Name: NF14927_low_52
Description: NF14927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14927_low_52 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 92; Significance: 7e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 34894670 - 34894579
Alignment:
| Q |
1 |
tcgagtttttgcgtttattgtgcttttggttctactcattgtcaatgttgttgttgatggaggagaaattttattgtactacactcagtaag |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34894670 |
tcgagtttttgcgtttattgtgcttttggttctactcattgtcaatgttgttgttgatggaggagaaattttattgtactacactcagtaag |
34894579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 137 - 201
Target Start/End: Complemental strand, 34894534 - 34894467
Alignment:
| Q |
137 |
ggaagaacattatgaatgaggcctatgtatatata---acattataatttgttttaagattttaacac |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34894534 |
ggaagaacattatgaatgaggcctatgtatatatacattaattataatttgttttaagattttaacac |
34894467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University