View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14927_low_52 (Length: 201)

Name: NF14927_low_52
Description: NF14927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14927_low_52
NF14927_low_52
[»] chr3 (2 HSPs)
chr3 (1-92)||(34894579-34894670)
chr3 (137-201)||(34894467-34894534)


Alignment Details
Target: chr3 (Bit Score: 92; Significance: 7e-45; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 34894670 - 34894579
Alignment:
1 tcgagtttttgcgtttattgtgcttttggttctactcattgtcaatgttgttgttgatggaggagaaattttattgtactacactcagtaag 92  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34894670 tcgagtttttgcgtttattgtgcttttggttctactcattgtcaatgttgttgttgatggaggagaaattttattgtactacactcagtaag 34894579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 137 - 201
Target Start/End: Complemental strand, 34894534 - 34894467
Alignment:
137 ggaagaacattatgaatgaggcctatgtatatata---acattataatttgttttaagattttaacac 201  Q
    |||||||||||||||||||||||||||||||||||     ||||||||||||||||||||||||||||    
34894534 ggaagaacattatgaatgaggcctatgtatatatacattaattataatttgttttaagattttaacac 34894467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University