View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14927_low_7 (Length: 494)
Name: NF14927_low_7
Description: NF14927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14927_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 241; Significance: 1e-133; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 18 - 266
Target Start/End: Original strand, 43896955 - 43897203
Alignment:
| Q |
18 |
gaaaccctatggagtagcgattttcaggaatccttgtaaaacggtaatggcacaagcgaggattcaatcgtttgagatcttcgcacgtgcggtggctaaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43896955 |
gaaaccctatggagtagcgattttcaggaatccttgtaaaacggtaatggcacaagcgaggattcaatcgtttgagatcttcgcacgtgcggttgctaaa |
43897054 |
T |
|
| Q |
118 |
atgcgcggtgggaatgctaatgtgaaacatgtttggtatggtgcttctagtagagaagagattgttgatattattcaacacggttttggttatgttcata |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43897055 |
atgcgcggtgggaatgctaatgtgaaacatgtttggtatggtgcttctagtagagaagagattgttgatattattcaacacggttttggttatgttcata |
43897154 |
T |
|
| Q |
218 |
gcaatggtttgcgtctttctccgaatgatactccacttgaaaggtacgc |
266 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43897155 |
gcaatggtctgcgtctttctccgaatgatactccacttgaaaggtacgc |
43897203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 417 - 480
Target Start/End: Original strand, 43897353 - 43897416
Alignment:
| Q |
417 |
acagtgtgaaaagaaccgttgttgacaaacaaggatttaggcacttgttgctttgtcgtgtgat |
480 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43897353 |
acagtgtgaaaagaactgttgttgacaaacaaggatttaggcacttgttgctttgtcgtgtgat |
43897416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University