View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14928_high_18 (Length: 243)
Name: NF14928_high_18
Description: NF14928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14928_high_18 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 125 - 243
Target Start/End: Complemental strand, 42631912 - 42631794
Alignment:
| Q |
125 |
gaacactaaccttgacttgctttgattcagaataaacaaagagaaagaagccaagaagaagaccaagaggaattccaatagcaaaaccaaaaacacccaa |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42631912 |
gaacactaaccttgacttgctttgattcagaataaacaaagagaaagaagccaagaagaagaccaagagggattccaatagcaaaaccaaaaacacccaa |
42631813 |
T |
|
| Q |
225 |
gaaactttcaaagaacccc |
243 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
42631812 |
gaaactttcaaagaacccc |
42631794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University