View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14928_low_10 (Length: 331)
Name: NF14928_low_10
Description: NF14928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14928_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 4e-66; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 155 - 298
Target Start/End: Original strand, 40884239 - 40884382
Alignment:
| Q |
155 |
ttttgtggttagaatttaaaccttgatcattgtatattgtaatgtattgtctttatcaattgcgtgatgttaatagagacatacccattatcttcttaca |
254 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
40884239 |
ttttgtggttagaatttaaacctcgatcattgtatattgtaatgtattgtctttatcaattgcgtgatgttaatagagacatacccattatttacttaca |
40884338 |
T |
 |
| Q |
255 |
agaatcaacatatttatttaattttcacatgattttttaaatca |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40884339 |
agaatcaacatatttatttaattttcacattattttttaaatca |
40884382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University