View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14928_low_14 (Length: 282)
Name: NF14928_low_14
Description: NF14928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14928_low_14 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 174 - 282
Target Start/End: Original strand, 42631704 - 42631812
Alignment:
| Q |
174 |
cctcgccaccttaaactgcgtcggaaactgttaaaccttatccttcaaacgttaaaccataatttcttcattgctctgttcaccaaaaatggggttcttt |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42631704 |
cctcgccaccttaaactgcgtcggaaactgttaaaccttttccttcaaacgttaaaccataatttcttcattgctctgttcaccaaaaatggggttcttt |
42631803 |
T |
|
| Q |
274 |
gaaagtttc |
282 |
Q |
| |
|
||||||||| |
|
|
| T |
42631804 |
gaaagtttc |
42631812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 6 - 98
Target Start/End: Original strand, 42631534 - 42631626
Alignment:
| Q |
6 |
cataggagggtgtctgtcatgttctggttttggcgctttcataaccactcacaattttcttagttccatttcttgccatattcaccatataac |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42631534 |
cataggagggtgtctgtcatgttctggttttggcgctttcataaccactcacaattttcttagttccatttcttgccatattcaccatataac |
42631626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University