View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14929_low_13 (Length: 252)
Name: NF14929_low_13
Description: NF14929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14929_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 43184580 - 43184461
Alignment:
| Q |
1 |
ttcgtcaaagaattctcagtcatcatcaccataaccatattgaaaatactcacggttcttactgtgtatttgcctaatcataagtattttaattaagcta |
100 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43184580 |
ttcgtcaaagaattctcagccatca---ccataaccatattgaaaatactcacggttcttactgtgtatttgcctaatcataagtattttaatcaagcta |
43184484 |
T |
 |
| Q |
101 |
ttaattattgcaatttaggttgg |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
43184483 |
ttaattattgcaatttaggttgg |
43184461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 162 - 235
Target Start/End: Complemental strand, 43184424 - 43184351
Alignment:
| Q |
162 |
catgttagtgtcaatggtcagtttttatgtcccccagttctttgtatgttttcatctttggatttcgtaacata |
235 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43184424 |
catgttggtgtcaatggtcaggttttatgtcccccagttctttgtatgctttcatctttggatttcgtaacata |
43184351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University