View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1492_high_62 (Length: 237)

Name: NF1492_high_62
Description: NF1492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1492_high_62
NF1492_high_62
[»] chr6 (4 HSPs)
chr6 (1-61)||(30715918-30715978)
chr6 (32-90)||(30734369-30734427)
chr6 (47-115)||(30716028-30716097)
chr6 (167-222)||(30734895-30734952)


Alignment Details
Target: chr6 (Bit Score: 53; Significance: 2e-21; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 30715918 - 30715978
Alignment:
Q  1 tggtgtttattaatcaatattgtagatattgtcaatacatgtagtggtgttgtcctagttt 61  Q
    |||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||    
T  30715918 tggtgtttattaatcaatattgtagatattgttaatatatgtagtggtgttgtcctagttt 30715978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 32 - 90
Target Start/End: Original strand, 30734369 - 30734427
Alignment:
Q  32 tcaatacatgtagtggtgttgtcctagtttaaatcgtgctcaaaatttatatggtgggt 90  Q
    |||||| ||||||||||||||||||||||||||| |||||||||||  |||||||||||    
T  30734369 tcaatatatgtagtggtgttgtcctagtttaaattgtgctcaaaatgaatatggtgggt 30734427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 47 - 115
Target Start/End: Original strand, 30716028 - 30716097
Alignment:
Q  47 gtgttgtcctagtttaaatcgtgctcaaaatttatatggtgggtgttgatgagtttg-aatatgatgatc 115  Q
    ||||||||||||||||||| |||||||||||  ||| ||||||||||||||| |||| ||||||||||||    
T  30716028 gtgttgtcctagtttaaattgtgctcaaaatgaataaggtgggtgttgatgaatttgaaatatgatgatc 30716097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 167 - 222
Target Start/End: Original strand, 30734895 - 30734952
Alignment:
Q  167 tttatgacatgtctatcaaacagaatt--tagtgatgcaatcaaacaaaaagaaatat 222  Q
    ||||||||||||||||||||| |||||  ||||| |||||||||||||||||||||||    
T  30734895 tttatgacatgtctatcaaacggaatttatagtgttgcaatcaaacaaaaagaaatat 30734952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University