View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1492_high_64 (Length: 236)
Name: NF1492_high_64
Description: NF1492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1492_high_64 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 55; Significance: 1e-22; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 41912124 - 41912182
Alignment:
| Q |
1 |
ataaagttcttttacattgttcaatattgttcctattatactatgcctcccattgtttt |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41912124 |
ataaagttcttttactttgttcaatattgttcctattatactatgcctcccattgtttt |
41912182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 165 - 222
Target Start/End: Original strand, 41912277 - 41912334
Alignment:
| Q |
165 |
cagcccaaatatattccatttatatattgttataaatattgtaatttggttacttttt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
41912277 |
cagcccaaatatattccatttatatattgtcatagatattgtaatttggttacttttt |
41912334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 62 - 91
Target Start/End: Original strand, 41912175 - 41912204
Alignment:
| Q |
62 |
attgtttttatttcactgatatttaattaa |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41912175 |
attgtttttatttcactgatatttaattaa |
41912204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University