View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1492_low_41 (Length: 296)
Name: NF1492_low_41
Description: NF1492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1492_low_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 14 - 291
Target Start/End: Complemental strand, 48272059 - 48271782
Alignment:
| Q |
14 |
aattcctcagctgtccctgcaccatccgtgtcatattccggattagttgttcccgaccttgagctaccgttggatccaatgctcaagtctttgattcctt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48272059 |
aattcctcagctgtccctgcaccatccgtgtcatattccggattagttgttcccgaccttgagctaccgttggatccaatgctcaagtctttgattcctt |
48271960 |
T |
 |
| Q |
114 |
tagctatgtctggagtgctagtacccgatgacgcagcggttctgacctgctcgaaatgtagtacctgcacaattacacgtgtcggtagcctctcgttttg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48271959 |
tagctatgtctggagtgctagtacccgatgacgcggcggttctgacctgctcgaaatgtagtacctgcacaattacacgtgtcggtagcctctcgttttg |
48271860 |
T |
 |
| Q |
214 |
cactgcatgcaaggatgcatcaactgacagctttctgcaatccattagctggcatatactcttcttttcacctttgct |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48271859 |
cactgcatgcaaggatgcatcaactgacagctttctgcaatccattagctggcatatactcttcttttcacctttgct |
48271782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University