View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1492_low_42 (Length: 296)
Name: NF1492_low_42
Description: NF1492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1492_low_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 91 - 289
Target Start/End: Complemental strand, 44533930 - 44533732
Alignment:
| Q |
91 |
ccacatcaccctcttcaaatgtagttggaggtctccattgttgttctggctgcaccatcaatggctccatcgtctcatttgacttcatgctatgaaacga |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44533930 |
ccacatcaccctcttcaaatgtagttggaggtctccattgttgttctggctgcaccatcaatggctccatcgtctcatttgacttcatgctatgaaacga |
44533831 |
T |
 |
| Q |
191 |
attagaaccaaaaaggttctgtgttttgttcttttctttgtaaatagcttcaagttcattaaaataaggacatgtcttactatcatcacgcctttgctt |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44533830 |
attagaaccaaaaaggttctgtgttttgttcttttctttgtaaatagcttcaagttcattaaaataaggacatgtcttactatcatcacgcctttgctt |
44533732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University