View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1492_low_43 (Length: 294)
Name: NF1492_low_43
Description: NF1492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1492_low_43 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 282
Target Start/End: Complemental strand, 43410034 - 43409749
Alignment:
| Q |
1 |
ttgagaccgagttgttggataataagagccgtgacatagttttatttaattaattaattaa----aactgaaattgaattttacaagtcacttaccaccg |
96 |
Q |
| |
|
|||||| |||||||||||||||||| | || |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43410034 |
ttgagatcgagttgttggataataatatccatgacatagttttatttaattaattaattaattaaaactgaaattgaattttacaagtcacttaccaccg |
43409935 |
T |
|
| Q |
97 |
atgctctttgcagcgtcctttaggcttccggcaaagtattgtctcagaaccggcaagcttatagtcttctccgccttggttcttcgcttgtccccggact |
196 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43409934 |
atgctctttgcggcgtcctttaggcttccggcaaagtattgtctcagaaccggcaagcttatagtcttctccgccttggttcttcgcttgtccccggact |
43409835 |
T |
|
| Q |
197 |
ttctcccactcgaagaagaagacgaccggcgaccacaggcaccaggagattcttcaccagcttctacacttacaacacttgccctt |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43409834 |
ttctcccactcgaagaagaagacgaccggcgaccacaggcaccaggagattcttcaccagcttctacacttacaacacttgccctt |
43409749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University